Query (optional)   in Class  

GrainGenes Marker Report: Xgwm301-2D

[ Submit comment/correction ]

Locus
Xgwm301-2D
Type
Microsatellite
Chromosome
2D
Chromosome Arm
2DL
Map
Chinese_Spring_Deletion_SSR_2D0.88
[ Show all 9 ]
[ Show Nearby Loci ]
Breakpoint Interval
2DL9-0.76-1.00
Map Data
Wheat 2008, Corrigin x CS(T2D), C gene
[ Show all 9 ]
Species
Triticum aestivum
Probe
WMS301
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
ReferenceSomers DJ et al. (2003) Molecular mapping of novel genes controlling Fusarium head blight resistance and deoxynivalenol accumulation in spring wheat Genome 46:555-564.
ReferencePaillard S et al. (2003) An integrative genetic linkage map of winter wheat (Triticum aestivum L.) Theoretical and Applied Genetics 107:1235-1242.
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
Data Source
Roeder, Marion S.98.09.15
Remark
In Map Ta-Synthetic/Opata-SSR-2D, the intervals most likely to contain locus are Xcdo1008 - Xcdo36 or distal to Xcdo36
Possible Orthologs
Xgwm301a
Xgwm301b
gwm301
Xgwm301



Probe for Locus
WMS301
Locus
Xgwm301-2D
Xgwm301a
Xgwm301b
gwm301
Xgwm301
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (GA)31(G)12
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' GAGGAGTAAGACACATGCCC 3'
5' GTGGCTGGAGATTCAGGTTC 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 55 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS301
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.