Query (optional)   in Class  

GrainGenes Marker Report: 0090G

[ Printable Version ]  [ Submit comment/correction ]

Locus
0090G
Type
Microsatellite
Map
Barley, B73xCPI-1H52.3
[ Show Nearby Loci ]
Map Data
Barley, B73xCPI
Probe
0090G



Probe
0090G
Locus
0090G
Reference
ReferenceHearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391.
Type
SSR
PCR primers
CCGCACATAGTGGTTACATCGAA
TCATAGACCTACCGCTCCATAGTTG