Query (optional)   in Class  

GrainGenes Marker Report: 0211C

[ Printable Version ]  [ Submit comment/correction ]

Locus
0211C
Type
Microsatellite
Map
Barley, B73xCPI-1H50.9
[ Show Nearby Loci ]
Map Data
Barley, B73xCPI
Probe
0211C



Probe
0211C
Locus
0211C
Reference
ReferenceHayden MJ et al. (2008) Multiplex-Ready PCR: A new method for multiplexed SSR and SNP genotyping BMC Genomics 9:80.
ReferenceHearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391.
Type
SSR
PCR primers
ACATCATGTCGATCAAAGCGAAGA
TAGTCCACTTGCCGTGTAGACAT
Forward ACATCATGTCGATCAAAGCGAAGA
Reverse TAGTCCACTTGCCGTGTAGACAT