Query (optional)   in Class  

GrainGenes Marker Report: 0211F

Locus
0211F
Type
Microsatellite
Map
Barley, B73xCPI-1H50.9
[ Show Nearby Loci ]
Map Data
Barley, B73xCPI
Probe
0211F



Probe
0211F
Locus
0211F
Reference
ReferenceHearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391.
Type
SSR
PCR primers
GATCATTGTATTGAAGATCAAGA
GGAGGCAAAGGGGAAGGGATGCTT