Query (optional)   in Class  

GrainGenes Marker Report: 0501D

[ Printable Version ]  [ Submit comment/correction ]

Locus
0501D
Type
Microsatellite
Synonym
Synonym0501D(dm501f.4/dm501r.1)
Chromosome
1H
Map
Barley, B73xCPI-1H52.3
Hordeum-Consensus2006-DArT-1H62.5
[ Show Nearby Loci ]
Map Data
Barley, B73xCPI
Barley, Consensus 2006, DArT
Probe
0501D
Reference
ReferenceWenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
Remark
Number of populations contributing to the placement of 0501D in the Barley, Consensus 2006 DArT maps = 1



Probe
0501D
Locus
0501D
Reference
ReferenceHearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391.
Type
SSR
PCR primers
GCTCCTTTTCTCCTCATCCTACA
AGGGACAAAAATGGCTAAGC