Query (optional)   in Class  

GrainGenes Marker Report: baak12j16

[ Printable Version ]  [ Submit comment/correction ]

Probe
baak12j16
Locus
k00078
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remarks
Best BLAST Hit = P0019D06.29 [Oryza sativa (japonica cultivar-group)] dbj BAB16470.1 P0019D06.29 [Oryza sativa (japonica cultivar-group)]
Type
PCR
PCR primers
Left 5' - TACTAGGGTGGTTGCCTTGG
Right 5' - TCCAGACAGACATCAGCGAC
Sequence
AV911267
PCR size
455



Locus for Probe
k00078
Type
CAPS
Chromosome
3H
Map
Hv-HNxH602-3H54.1
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
baak12j16
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
[ Hide all but 1 of 6 ]
Restriction enzyme used for CAPS analysis = XhoI
SNP = G/A
SNP structure (UNICODE) = AGGTGAACTCRAGGTTTGGGC
Parent 1 SNP sequence = AGGTGAACTCGAGGTTTGGGC
Parent 2 SNP sequence = AGGTGAACTCAAGGTTTGGGC
Recognized sequence for CAPs locus = CTCGAG