Query (optional)   in Class  

GrainGenes Marker Report: BaAK12F04

[ Printable Version ]  [ Submit comment/correction ]

Probe
BaAK12F04
Locus
k06813
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remarks
Best BLAST Hit = integral membrane family protein [Arabidopsis thaliana] pir H84428 probable membrane protein [imported] - Arabidopsis thaliana
Type
PCR
PCR primers
Left 5' - TCTGGGACGCATTACAACTG
Right 5' - AGCAGAGCTACGCACAACCT
Sequence
BJ455892
PCR size
382



Locus for Probe
k06813
Type
SNP
Chromosome
2H
Map
Hv-HNxH602-2H138.3
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
BaAK12F04
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
SNP = C/A
[ Show all 11 ]