Query (optional)   in Class  

GrainGenes Marker Report: BaAK12F18

[ Printable Version ]  [ Submit comment/correction ]

Probe
BaAK12F18
Locus
k06822
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remarks
Best BLAST Hit = OSJNBa0093F12.14 [Oryza sativa (japonica cultivar-group)]
Type
PCR
PCR primers
Left 5' - TGGAAGTGTTGACTCCCTCA
Right 5' - GAAGGTGGTTTCAGCCATGT
Sequence
AV911198
PCR size
379



Locus for Probe
k06822
Type
SNP
Chromosome
6H
Map
Hv-HNxH602-6H118.9
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
BaAK12F18
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
SNP = C/A
[ Show all 22 ]