Query (optional)   in Class  

GrainGenes Marker Report: BaAK12I12

[ Printable Version ]  [ Submit comment/correction ]

Probe
BaAK12I12
Locus
k06326
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remarks
Best BLAST Hit = putative Rab5-interacting protein - like [Arabidopsis thaliana]
Type
PCR
PCR primers
Left 5' - TCCTGCTATTCTGCGTTCCT
Right 5' - CGCGACTCCCAATTTTTAGA
Sequence
BQ665919
PCR size
363



Locus for Probe
k06326
Type
SNP
Chromosome
1H
Map
Hv-HNxH602-1H44.1
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
BaAK12I12
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
SNP = G/T
[ Show all 12 ]