Query (optional)   in Class  

GrainGenes Marker Report: BaAK12J13

[ Printable Version ]  [ Submit comment/correction ]

Probe
BaAK12J13
Locus
k06417
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remarks
Best BLAST Hit = OSJNBa0044K18.24 [Oryza sativa (japonica cultivar-group)]
Type
PCR
PCR primers
Left 5' - CACGGATCAAAGCAGAAACA
Right 5' - ATCTTCTCGCCCATGCAC
Sequence
AV911265
PCR size
444



Locus for Probe
k06417
Type
CAPS
Chromosome
6H
Map
Hv-HNxH602-6H102.3
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
BaAK12J13
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
Restriction enzyme used for CAPS analysis = HapII
[ Show all 6 ]