Query (optional)   in Class  

GrainGenes Marker Report: BaAK12L24

[ Printable Version ]  [ Submit comment/correction ]

Probe
BaAK12L24
Locus
k06126
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remarks
Best BLAST Hit = MAP kinase kinase 1 [Oryza sativa]
Type
PCR
PCR primers
Left 5' - ATCACCGGATCAGAGCAACT
Right 5' - TGAATGTTCTGGATGTGGGA
Sequence
AV911305
PCR size
350



Locus for Probe
k06126
Type
CAPS
Chromosome
4H
Map
Hv-HNxH602-4H201.8
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
BaAK12L24
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
Restriction enzyme used for CAPS analysis = MvaI
[ Show all 6 ]