Query (optional)   in Class  

GrainGenes Marker Report: BaAK12P03

[ Printable Version ]  [ Submit comment/correction ]

Probe
BaAK12P03
Locus
k06364
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remarks
Best BLAST Hit = OSJNBa0067K08.13 [Oryza sativa (japonica cultivar-group)]
Type
PCR
PCR primers
Left 5' - AACAGACGGGAATCACAAGG
Right 5' - GGAACAGACGAGGGGGTTAT
Sequence
AV911358
PCR size
365



Locus for Probe
k06364
Type
SNP
Chromosome
5H
Map
Hv-HNxH602-5H164.3
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
BaAK12P03
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
SNP = G/A
[ Show all 8 ]