Query (optional)   in Class  

GrainGenes Marker Report: BaAK13B12

[ Printable Version ]  [ Submit comment/correction ]

Probe
BaAK13B12
Locus
k06142
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Type
PCR
PCR primers
Left 5' - CACGGGACATGAAGATTGTG
Right 5' - GTCACTCTGTTCAGCGCCT
Sequence
AV911405
PCR size
352



Locus for Probe
k06142
Type
SNP
Chromosome
4H
Map
Hv-HNxH602-4H204
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
BaAK13B12
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
SNP = A/C
[ Show all 8 ]