Query (optional)   in Class  

GrainGenes Marker Report: BaAK13C16

[ Printable Version ]  [ Submit comment/correction ]

Probe
BaAK13C16
Locus
k06270
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remarks
Best BLAST Hit = putative indole-3-glycerol phosphate lyase [Oryza sativa (japonica cultivar-group)]
Type
PCR
PCR primers
Left 5' - CCTTCCAGATATCAAGCAGCA
Right 5' - TGGCGACGATAAAAGAAAGG
Sequence
AV911429
PCR size
254



Locus for Probe
k06270
Type
SNP
Chromosome
3H
Map
Hv-HNxH602-3H13.1
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
BaAK13C16
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
SNP = A/G
SNP structure (UNICODE) = CTCATGTACARTTAGTACACA
Parent 1 SNP sequence = CTCATGTACAATTAGTACACA
Parent 2 SNP sequence = CTCATGTACAGTTAGTACACA