Query (optional)   in Class  

GrainGenes Marker Report: baak11c22

[ Printable Version ]  [ Submit comment/correction ]

Probe
baak11c22
Locus
k00073
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remarks
Best BLAST Hit = leucine-rich repeat family protein [Arabidopsis thaliana] gb AAM13067.1 unknown protein [Arabidopsis thaliana]
Type
PCR
PCR primers
Left 5' - CCCCGGCTATCACAATAGAA
Right 5' - CCAGAAGAACCGAAGACCAG
Sequence
AV910871
PCR size
350



Locus for Probe
k00073
Type
CAPS
Chromosome
4H
Map
Hv-HNxH602-4H137
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
baak11c22
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
Restriction enzyme used for CAPS analysis = TaqI
[ Show all 9 ]