Query (optional)   in Class  

GrainGenes Marker Report: baak12d02

[ Printable Version ]  [ Submit comment/correction ]

Probe
baak12d02
Locus
k00017
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remarks
Best BLAST Hit = rubisco expression protein -related [Arabidopsis thaliana] gb AAK28639.1 putative rubisco expression protein [Arabidopsis thaliana]
Type
PCR
PCR primers
Left 5' - CCAGACTGACGATTTGGGAT
Right 5' - GTGAAGCAATTCATGCAAGC
Sequence
AV911144
PCR size
389



Locus for Probe
k00017
Type
SNP
Chromosome
6H
Map
Hv-HNxH602-6H100.2
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
baak12d02
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
SNP = G/C
SNP structure (UNICODE) = CATCGTTCGASGCAATGACAC
Parent 1 SNP sequence = CATCGTTCGAGGCAATGACAC
Parent 2 SNP sequence = CATCGTTCGACGCAATGACAC