Query (optional)   in Class  

GrainGenes Marker Report: baak12d06

[ Printable Version ]  [ Submit comment/correction ]

Probe
baak12d06
Locus
k00029
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remarks
Best BLAST Hit = timing of CAB expression 1-like protein [Brassica rapa subsp. pekinensis]
Type
PCR
PCR primers
Left 5' - CATTTTGTCCTCCGGCTTTA
Right 5' - TCTCTGCCAAAGAAGTGGCT
Sequence
BJ455330
PCR size
459



Locus for Probe
k00029
Type
CAPS
Chromosome
5H
Map
Hv-HNxH602-5H172.7
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
baak12d06
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
Restriction enzyme used for CAPS analysis = HhaI
[ Show all 6 ]