Query (optional)   in Class  

GrainGenes Marker Report: baak12j24

[ Printable Version ]  [ Submit comment/correction ]

Probe
baak12j24
Locus
k00090
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remarks
Best BLAST Hit = probable acyl-CoA oxidase (EC 1.3.3.6), peroxisomal - barley emb CAA04688.1 putative acyl-CoA oxidase [Hordeum vulgare subsp. vulgare]
Type
PCR
PCR primers
Left 5' - CACCTTCTTCTCCGTCAAGC
Right 5' - ATTGAAGTACGCCGGAACAG
Sequence
AV911272
PCR size
431



Locus for Probe
k00090
Type
CAPS
Chromosome
7H
Map
Hv-HNxH602-7H9.4
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
baak12j24
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
Restriction enzyme used for CAPS analysis = SacII
[ Show all 6 ]