Query (optional)   in Class  

GrainGenes Marker Report: baak12l16

[ Printable Version ]  [ Submit comment/correction ]

Probe
baak12l16
Locus
k00043
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remarks
Best BLAST Hit = expressed protein [Arabidopsis thaliana]
Type
PCR
PCR primers
Left 5' - CCTTGAGCAGACAACACCAA
Right 5' - AGCCCAATGCCTGATACG
Sequence
AV911299
PCR size
350



Locus for Probe
k00043
Type
SNP
Chromosome
7H
Map
Hv-HNxH602-7H156.4
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
baak12l16
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
SNP = A/G
SNP structure (UNICODE) = AATCATAATCRTTGCTATAAC
Parent 1 SNP sequence = AATCATAATCATTGCTATAAC
Parent 2 SNP sequence = AATCATAATCGTTGCTATAAC