Query (optional)   in Class  

GrainGenes Marker Report: baak12p11

[ Printable Version ]  [ Submit comment/correction ]

Probe
baak12p11
Locus
k00079
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remarks
Best BLAST Hit = putative transcription regulatory protein [Oryza sativa (japonica cultivar-group)]
Type
PCR
PCR primers
Left 5' - CCACGTCGTCGTGTCAATAC
Right 5' - CCACCACACCAGACATTGAA
Sequence
CA001274
PCR size
352



Locus for Probe
k00079
Type
SNP
Chromosome
1H
Map
Hv-HNxH602-1H116.4
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
baak12p11
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
SNP = A/G
SNP structure (UNICODE) = AGAAGTAGTGRGTATGATTGT
Parent 1 SNP sequence = AGAAGTAGTGAGTATGATTGT
Parent 2 SNP sequence = AGAAGTAGTGGGTATGATTGT