Query (optional)   in Class  

GrainGenes Marker Report: baak13d19

[ Printable Version ]  [ Submit comment/correction ]

Probe
baak13d19
Locus
k00009
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remarks
Best BLAST Hit = phosphoglycerate mutase - like protein [Arabidopsis thaliana]
Type
PCR
PCR primers
Left 5' - AACGCCTATGCTGGTTATGC
Right 5' - GGCCAGTTGTGACCTTGATT
Sequence
AV911452
PCR size
352



Locus for Probe
k00009
Type
SNP
Chromosome
6H
Map
Hv-HNxH602-6H94.7
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
baak13d19
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
SNP = G/A
[ Show all 7 ]