Query (optional)   in Class  

GrainGenes Marker Report: C002

Locus
C002
Type
RFLP
Map
Tt-Gill-4D142.2
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuC2
Possible Orthologs
XksuC2
XksuC2-4D



Probe for Locus
pTtksuC2
Locus
XksuC2-4B
[ Show all 11 ]
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type
Genomic
STS
PCR primers
R:TTTCGCTGTGGCACTTGTAC
L:ATGGAGAAGTCTTACCTCAGC
Specificity
Primer specificity verified, maps on chromosome 4DL.
Linkage Group
4D / 4D
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
2.2
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09