Query (optional)   in Class  

GrainGenes Marker Report: C002

[ Printable Version ]  [ Submit comment/correction ]

Locus
C002
Type
RFLP
Map
Tt-Gill-4D142.2
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuC2
Possible Orthologs
XksuC2
XksuC2-4D



Probe for Locus
pTtksuC2
Locus
[ Hide all but 1 of 11 ]
XksuC2-4B
XksuC2-4D
XksuC2
HI050G18
D1.1_ctg3351
C002
XksuC2-2A
XksuC2-5A
ksuC2B
ksuC2A
XksuC2b
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type
Genomic
STS
PCR primers
R:TTTCGCTGTGGCACTTGTAC
L:ATGGAGAAGTCTTACCTCAGC
Specificity
Primer specificity verified, maps on chromosome 4DL.
Linkage Group
4D / 4D
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
2.2
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09