Query (optional)   in Class  

GrainGenes Marker Report: CWEM49

[ Printable Version ]  [ Submit comment/correction ]

Probe
CWEM49
Locus
Xcwem49a
[ Show all 6 ]
Remarks
SSR motif: (GCC)6
Type
PCR
SSR
EST
PCR primers
Left GAGGAGGACTCCATCGTCTT
Right GCTTCCCGAACGAAGAACT
Amplification Conditions
Annealing temperature 55
Sequence
BE445201
Data Source
Peng, Junhua2005.05



Locus for Probe
Xcwem49a
Type
Microsatellite
Chromosome
6B, 87bp
Chromosome Arm
6BS, 87bp
Probe
CWEM49
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.



Locus for Probe
Xcwem49b
Type
Microsatellite
Chromosome
6D, 89bp
Chromosome Arm
6DS, 89bp
Probe
CWEM49
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.



Locus for Probe
Xcwem49c
Type
Microsatellite
Chromosome
6B or 6DS, 90bp
Chromosome Arm
6BS or 6DS , 90bp
Probe
CWEM49
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.



Locus for Probe
Xcwem49d
Type
Microsatellite
Chromosome
6A or 6D, 97bp
Chromosome Arm
6AS or 6DS, 97bp
Probe
CWEM49
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.



Locus for Probe
Xcwem49e
Type
Microsatellite
Chromosome
6A or 6B, 101bp
Chromosome Arm
6AS or 6BS, 101bp
Probe
CWEM49
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.



Locus for Probe
Xcwem49f
Type
Microsatellite
Chromosome
6A, 121bp
Chromosome Arm
6AS, 121bp
Probe
CWEM49
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.