Query (optional)   in Class  

GrainGenes Marker Report: CWEM5

[ Printable Version ]  [ Submit comment/correction ]

Probe
CWEM5
Locus
Xcwem5a
[ Show all 9 ]
Remarks
SSR motif: (AGC)6
Type
PCR
SSR
EST
PCR primers
Left CTCCCTCTGCCCCTCTTG
Right CAGCTCGCCTGTATCCATCT
Amplification Conditions
Annealing temperature 55
Sequence
BG274942
Data Source
Peng, Junhua2005.05



Locus for Probe
Xcwem5a
Type
Microsatellite
Chromosome
1D, 126bp
Chromosome Arm
1DL, 126bp
Probe
CWEM5
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.



Locus for Probe
Xcwem5b
Type
Microsatellite
Chromosome
2B, 165bp
Chromosome Arm
2BL, 165bp
Probe
CWEM5
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.



Locus for Probe
Xcwem5c
Type
Microsatellite
Chromosome
2B, 230bp
Chromosome Arm
2BS, 230bp
Probe
CWEM5
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.



Locus for Probe
Xcwem5d
Type
Microsatellite
Chromosome
2D, 290bp
Chromosome Arm
2DL, 290bp
Probe
CWEM5
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.



Locus for Probe
Xcwem5e
Type
Microsatellite
Chromosome
2A, 310bp
Chromosome Arm
2AL, 310bp
Probe
CWEM5
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.



Locus for Probe
Xcwem5f
Type
Microsatellite
Chromosome
2A or 2D, 350bp
Chromosome Arm
2AL or 2DL, 350bp
Probe
CWEM5
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.



Locus for Probe
Xcwem5g
Type
Microsatellite
Chromosome
3A, 725bp
Chromosome Arm
3AL, 725bp
Probe
CWEM5
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.



Locus for Probe
Xcwem5h
Type
Microsatellite
Chromosome
4A, 800bp
Chromosome Arm
4AL, 800bp
Probe
CWEM5
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.



Locus for Probe
Xcwem5i
Type
Microsatellite
Chromosome
6A, 1000bp
Chromosome Arm
6AS, 1000bp
Probe
CWEM5
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.