Query (optional)   in Class  

GrainGenes Marker Report: CWEM51

[ Printable Version ]  [ Submit comment/correction ]

Probe
CWEM51
Locus
Xcwem51
Remarks
SSR motif: (CCAT)6
Type
PCR
SSR
EST
PCR primers
Left CGACAAGAACAAAGCCTGAG
Right CCTCTATCGCGCTGTTGATT
Amplification Conditions
Annealing temperature 55
Sequence
BE405680
Data Source
Peng, Junhua2005.05



Locus for Probe
Xcwem51
Type
Microsatellite
Chromosome
6D, 89bp
Chromosome Arm
6DL, 89bp
Probe
CWEM51
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.