Query (optional)   in Class  

GrainGenes Marker Report: CWEM52

[ Printable Version ]  [ Submit comment/correction ]

Probe
CWEM52
Locus
Xcwem52
Remarks
SSR motif: (GCAAAC)5
Type
PCR
SSR
EST
PCR primers
Left CCTACCTACGACGCAAGTCC
Right AGCGAGCAGAAAGCATCAAG
Amplification Conditions
Annealing temperature 55
Sequence
BE399084
Data Source
Peng, Junhua2005.05



Locus for Probe
Xcwem52
Type
Microsatellite
Chromosome
7B, 165bp
Chromosome Arm
7BL, 165bp
Probe
CWEM52
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.