Query (optional)   in Class  

GrainGenes Marker Report: CWEM53

[ Printable Version ]  [ Submit comment/correction ]

Probe
CWEM53
Locus
Xcwem53a
Xcwem53b
Xcwem53c
Xcwem53d
Xcwem53e
Remarks
SSR motif: (CCG)5
Type
PCR
SSR
EST
PCR primers
Left ACGCACGCTCGCTTCAAT
Right GCAGTATCGTCTCCCTCTGC
Amplification Conditions
Annealing temperature 55
Sequence
BF484868
Data Source
Peng, Junhua2005.05



Locus for Probe
Xcwem53a
Type
Microsatellite
Chromosome
7B, 135bp
Chromosome Arm
7BS, 135bp
Probe
CWEM53
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.



Locus for Probe
Xcwem53b
Type
Microsatellite
Chromosome
7A, 153bp
Chromosome Arm
7AS, 153bp
Probe
CWEM53
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.



Locus for Probe
Xcwem53c
Type
Microsatellite
Chromosome
7B, 196bp
Chromosome Arm
7BS, 196bp
Probe
CWEM53
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.



Locus for Probe
Xcwem53d
Type
Microsatellite
Chromosome
6B, 420bp
Chromosome Arm
6BL, 420bp
Probe
CWEM53
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.



Locus for Probe
Xcwem53e
Type
Microsatellite
Chromosome
4B, 430bp
Chromosome Arm
4BS, 430bp
Probe
CWEM53
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.