Query (optional)   in Class  

GrainGenes Marker Report: CWEM54

[ Printable Version ]  [ Submit comment/correction ]

Probe
CWEM54
Locus
Xcwem54a
[ Show all 6 ]
Remarks
SSR motif: (CCG)5
Type
PCR
SSR
EST
PCR primers
Left AGCCAAAGGAGCTGGAGGAC
Right GGCTCCGTGCTCCTCGAC
Amplification Conditions
Annealing temperature 55
Sequence
BE517937
Data Source
Peng, Junhua2005.05



Locus for Probe
Xcwem54a
Type
Microsatellite
Chromosome
7A, 180bp
Chromosome Arm
7AS, 180bp
Probe
CWEM54
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.



Locus for Probe
Xcwem54b
Type
Microsatellite
Chromosome
5A, 300bp
Chromosome Arm
5AL, 300bp
Probe
CWEM54
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.



Locus for Probe
Xcwem54c
Type
Microsatellite
Chromosome
1B, 370bp
Chromosome Arm
1BS, 370bp
Probe
CWEM54
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.



Locus for Probe
Xcwem54d
Type
Microsatellite
Chromosome
2B, 700bp
Chromosome Arm
2BS, 700bp
Probe
CWEM54
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.



Locus for Probe
Xcwem54e
Type
Microsatellite
Chromosome
7D, 800bp
Chromosome Arm
7DL, 800bp
Probe
CWEM54
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.



Locus for Probe
Xcwem54f
Type
Microsatellite
Chromosome
6D, 900bp
Chromosome Arm
6DS, 900bp
Probe
CWEM54
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.