Query (optional)   in Class  

GrainGenes Marker Report: CWEM56

[ Printable Version ]  [ Submit comment/correction ]

Probe
CWEM56
Locus
Xcwem56a
Xcwem56b
Xcwem56c
Remarks
SSR motif: (CCG)6
Type
PCR
SSR
EST
PCR primers
Left CCAAGTGTCAGCAACAAGCA
Right TAGACGAACACGCTGTGGTG
Amplification Conditions
Annealing temperature 55
Sequence
BE425936
Data Source
Peng, Junhua2005.05



Locus for Probe
Xcwem56a
Type
Microsatellite
Chromosome
7B, 115bp
Chromosome Arm
7BL, 115bp
Probe
CWEM56
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.



Locus for Probe
Xcwem56b
Type
Microsatellite
Chromosome
7B, 200bp
Chromosome Arm
7BL, 200bp
Probe
CWEM56
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.



Locus for Probe
Xcwem56c
Type
Microsatellite
Chromosome
2A, 400bp
Chromosome Arm
2AL, 400bp
Probe
CWEM56
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.