Query (optional)   in Class  

GrainGenes Marker Report: CWEM57

[ Printable Version ]  [ Submit comment/correction ]

Probe
CWEM57
Locus
Xcwem57a
Xcwem57b
Remarks
SSR motif: (TC)8
Type
PCR
SSR
EST
PCR primers
Left CCGTACGCCACCAATTTTAC
Right CTGATCCAGAACTCCATCTGC
Amplification Conditions
Annealing temperature 55
Sequence
BE590752
Data Source
Peng, Junhua2005.05



Locus for Probe
Xcwem57a
Type
Microsatellite
Chromosome
7B, 120bp
Chromosome Arm
7BS, 120bp
Probe
CWEM57
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.



Locus for Probe
Xcwem57b
Type
Microsatellite
Chromosome
7A, 150bp
Chromosome Arm
7AS, 150bp
Probe
CWEM57
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.