Query (optional)   in Class  

GrainGenes Marker Report: CWEM6

[ Printable Version ]  [ Submit comment/correction ]

Probe
CWEM6
Locus
Xcwem6a
Xcwem6b
Xcwem6c
Remarks
SSR motif: (AG)12
Type
PCR
SSR
EST
PCR primers
Left CCTGCTCTGCCATTACTTGG
Right TGCACCTCCATCTCCTTCTT
Amplification Conditions
Annealing temperature 55
Sequence
BF483588
Data Source
Peng, Junhua2005.05



Locus for Probe
Xcwem6a
Type
Microsatellite
Chromosome
1D, 145bp
Chromosome Arm
1DS, 145bp
Probe
CWEM6
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.



Locus for Probe
Xcwem6b
Type
Microsatellite
Chromosome
1A, 150bp
Chromosome Arm
1AS, 150bp
Probe
CWEM6
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.



Locus for Probe
Xcwem6c
Type
Microsatellite
Chromosome
1B, 165bp
Chromosome Arm
1BS, 165bp
Probe
CWEM6
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.