Query (optional)   in Class  

GrainGenes Marker Report: CWEM7

[ Printable Version ]  [ Submit comment/correction ]

Probe
CWEM7
Locus
Xcwem7a
[ Show all 7 ]
Remarks
SSR motif: (T)10
Type
PCR
SSR
EST
PCR primers
Left ACGGCGTGTTGAGTTTTTCT
Right CAACTGCAACAACAAAACAGT
Amplification Conditions
Annealing temperature 55
Sequence
BE500104
Data Source
Peng, Junhua2005.05



Locus for Probe
Xcwem7a
Type
Microsatellite
Chromosome
6B, 100bp
Chromosome Arm
6BL, 100bp
Probe
CWEM7
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.



Locus for Probe
Xcwem7b
Type
Microsatellite
Chromosome
6D, 104bp
Chromosome Arm
6DL, 104bp
Probe
CWEM7
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.



Locus for Probe
Xcwem7c
Type
Microsatellite
Chromosome
6B, 106bp
Chromosome Arm
6BL, 106bp
Probe
CWEM7
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.



Locus for Probe
Xcwem7d
Type
Microsatellite
Chromosome
6D, 108bp
Chromosome Arm
6DL, 108bp
Probe
CWEM7
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.



Locus for Probe
Xcwem7e
Type
Microsatellite
Chromosome
6A, 110bp
Chromosome Arm
6AL, 110bp
Probe
CWEM7
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.
Fragment is the smallest of two or more adjacent bands mapped to the same chromosome arm.



Locus for Probe
Xcwem7f
Type
Microsatellite
Chromosome
1B, 328bp
Chromosome Arm
1BS, 328bp
Probe
CWEM7
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.



Locus for Probe
Xcwem7g
Type
Microsatellite
Chromosome
6D, 452bp
Chromosome Arm
6DS, 452bp
Probe
CWEM7
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.