Query (optional)   in Class  

GrainGenes Marker Report: CWEM8

[ Printable Version ]  [ Submit comment/correction ]

Probe
CWEM8
Locus
Xcwem8a
Xcwem8b
Xcwem8c
Xcwem8d
Xcwem8e
Remarks
SSR motif: (TAC)5
Type
PCR
SSR
EST
PCR primers
Left TGTGCTTCAAGCCTCAAGTG
Right GCTCGCACTCGAGTACACTG
Amplification Conditions
Annealing temperature 55
Sequence
BE443007
Data Source
Peng, Junhua2005.05



Locus for Probe
Xcwem8a
Type
Microsatellite
Chromosome
2A, 131bp
Chromosome Arm
2AL, 131bp
Probe
CWEM8
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.



Locus for Probe
Xcwem8b
Type
Microsatellite
Chromosome
1D, 132bp
Chromosome Arm
1DS, 132bp
Probe
CWEM8
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.



Locus for Probe
Xcwem8c
Type
Microsatellite
Chromosome
7B, 135bp
Chromosome Arm
7BL, 135bp
Probe
CWEM8
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.



Locus for Probe
Xcwem8d
Type
Microsatellite
Chromosome
7A, 140bp
Chromosome Arm
7AL, 140bp
Probe
CWEM8
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.



Locus for Probe
Xcwem8e
Type
Microsatellite
Chromosome
3B, 147bp
Chromosome Arm
3BS, 147bp
Probe
CWEM8
Data Source
Peng, Junhua2005.05
Remark
SSR size determined in Chinese Spring aneuploids.