Query (optional)   in Class  

GrainGenes Marker Report: CYS

[ Printable Version ]  [ Submit comment/correction ]

Locus
CYS
Type
CAPS
Chromosome
5A
Chromosome Arm
5AL
Map
5AL, Vrn1 region-0.02
[ Show Nearby Loci ]
Map Data
5AL, Vrn1 region  Mapped_with_probe  AY244510/1
Species
Triticum monococcum
Probe
AY244510/1
Associated Gene
Cys-A1 (Triticum)
Gene Class
Cysteine proteinase
Reference
ReferenceYan L et al. (2003) Positional cloning of wheat vernalization gene VRN1. Proceedings of the National Academy of Sciences, USA 100:6263-6268.
Data Source
Dubcovsky, Jorge2003.04



Probe for Locus
AY244510/1
Locus
CYS
Reference
ReferenceYan L et al. (2003) Positional cloning of wheat vernalization gene VRN1. Proceedings of the National Academy of Sciences, USA 100:6263-6268.
Type
Genomic
STS
PCR primers
CYS-F TCATGGACAACGCCTTCGAGT
CYS-R CCAACAGGTTCGCCGACCTC
Sequence
AY244511
AY244510
Source Gene Class
Cysteine proteinase
Source Gene
Cys-A1 (Triticum)
Source Species
Triticum monococcum
Data Source
Dubcovsky, Jorge2003.04



Gene Associated with Locus
Cys-A1 (Triticum)
Gene Class
Cysteine proteinase
Locus
CYS
Reference
ReferenceYan L et al. (2003) Positional cloning of wheat vernalization gene VRN1. Proceedings of the National Academy of Sciences, USA 100:6263-6268.
Gene Product
cysteine proteinase
Chromosome
5A
Chromosome Arm
5AL
Clone
AY244510/1
Sequence
AY244510
AY244511
Data Source
Dubcovsky, Jorge2003.04