Query (optional)   in Class  

GrainGenes Marker Report: D002

[ Printable Version ]  [ Submit comment/correction ]

Locus
D002
Type
RFLP
Map
Tt-Gill-7D413.1
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuD2
Possible Orthologs
[ Hide all but 1 of 8 ]
XksuD2
XksuD2-6U
XksuD2-7A
XksuD2-7B
XksuD2-7D
XksuD2.2
ksuD2
ksuD2-7B



Probe for Locus
pTtksuD2
Locus
XksuD2-7A
[ Show all 9 ]
Type
Genomic
STS
PCR primers
R:CTCCCTGTTTGTGGAAAGCT
L:CGAATGTTTCTACTGCGCTGT
Specificity
Primer specificity verified, maps on chromosomes 7D, 7BL.
Polymorphism
KSUD2 XbaI
KSUD2 EcoRI
KSUD2 EcoRV
KSUD2 HindIII
KSUD2 DraI
Insert Enzyme
PstI
Source Species
Triticum tauschii
Insert Size
1
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUD2 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09