Query (optional)   in Class  

GrainGenes Marker Report: D018b

[ Printable Version ]  [ Submit comment/correction ]

Locus
D018b
Type
RFLP
Map
Tt-Gill-3D0
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuD18
Possible Orthologs
D018a
[ Show all 13 ]



Probe for Locus
pTtksuD18
Locus
[ Hide all but 1 of 17 ]
XksuD18-2
DGD18
XksuD18-2A
XksuD18-2B
XksuD18-7B
XksuD18-2A.1
XksuD18-2A.2
XksuD18-5B
XksuD18-2D.1
XksuD18-2D.2
Xksu.DGD18
D018a
D018b
XksuD18
ksuD18
XksuD18b
Xsts-ksuD18
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type
Genomic
STS
PCR primers
R:GGACACTAAACTTTAGAGGC
L:CCACTGTTAGGATTAGTGATCC
Specificity
Primer specificity verified, maps on chromosome 2AS.
Polymorphism
KSUD18 HindIII
Linkage Group
4D / 2D (2)
Insert Enzyme
PstI
Source Species
Triticum tauschii
Insert Size
1.2
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUD18 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09