Query (optional)   in Class  

GrainGenes Marker Report: D001

[ Printable Version ]  [ Submit comment/correction ]

Locus
D001
Type
RFLP
Map
Tt-Gill-6D409.7
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuD1
Possible Orthologs
XksuD1
[ Show all 6 ]



Probe for Locus
pTtksuD1
Locus
XksuD1-6
[ Show all 9 ]
Type
Genomic
STS
PCR primers
R:CTGTCAAAATCTGTTGGGTC
L:CGGATCCTATAAAGTAGCGC
Specificity
Primer specificity verified, maps on chromosome 6DL.
Polymorphism
KSUD1 EcoRI
Linkage Group
6D / 6D
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
0.8
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUD1 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09