Query (optional)   in Class  

GrainGenes Marker Report: D007a

[ Printable Version ]  [ Submit comment/correction ]

Locus
D007a
Type
RFLP
Map
Tt-Gill-7D151.9
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuD7
Possible Orthologs
XksuD7
XksuD7-3D
XksuD7-7B



Probe for Locus
pTtksuD7
Locus
XksuD7-7B
XksuD7-3D
HD030K13
D007a
XksuD7
Type
Genomic
STS
PCR primers
R:CTGCCGCCCTCTTGTTCATC
L:CATCCGCCCTCCCCTGTTCA
Linkage Group
7D / 3D
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1.4
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09