Query (optional)   in Class  

GrainGenes Marker Report: D009

[ Printable Version ]  [ Submit comment/correction ]

Locus
D009
Type
RFLP
Map
Tt-Gill-7D20.7
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuD9
Possible Orthologs
XksuD9
[ Show all 9 ]



Probe for Locus
pTtksuD9
Locus
XksuD9-4A
[ Show all 13 ]
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type
Genomic
STS
PCR primers
R:GGTGACGACCCGAGCGTTGAT
L:CACCAGATATTGCTTGCCTCC
Polymorphism
KSUD9 HindIII
KSUD9 EcoRI
KSUD9 EcoRV
KSUD9 DraI
KSUD9 XbaI
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Clone Vector
pUC18
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUD9 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
Gill, Bikram S.92.09