Query (optional)   in Class  

GrainGenes Marker Report: D012

[ Printable Version ]  [ Submit comment/correction ]

Locus
D012
Type
RFLP
Map
Tt-Gill-6D446.4
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuD12
Possible Orthologs
XksuD12
XksuD12-6
XksuD12-6A
XksuD12-6B
XksuD12-6D



Probe for Locus
pTtksuD12
Locus
XksuD12-6
[ Show all 13 ]
Type
Genomic
STS
PCR primers
R:GGCAATGAAGATCCACAGTC
L:GTTAATTATGGCCTGTAACC
Specificity
Primer specificity verified, maps on chromosome 6DL.
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Clone Vector
pUC18
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
Gill, Bikram S.92.09