Query (optional)   in Class  

GrainGenes Marker Report: D015

[ Printable Version ]  [ Submit comment/correction ]

Locus
D015
Type
RFLP
Map
Tt-Gill-7D200
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuD15
Possible Orthologs
XksuD15
XksuD15-7A
XksuD15-7B
XksuD15-7D



Probe for Locus
pTtksuD15
Locus
HI095J9
[ Show all 9 ]
Type
Genomic
STS
PCR primers
R:GCTGCCTGTTTTGTTTCGCA
L:GTCTTCACGGAGATCTGTAT
Linkage Group
7D
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1.4
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09