Query (optional)   in Class  

GrainGenes Marker Report: D017

[ Printable Version ]  [ Submit comment/correction ]

Locus
D017
Type
RFLP
Map
Tt-Gill-6D275.1
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuD17
Possible Orthologs
ksuD17
[ Show all 6 ]



Probe for Locus
pTtksuD17
Locus
ksuD17
[ Show all 9 ]
Type
Genomic
STS
PCR primers
R:CTGCTTGGGTCATCATGCAA
L:CAAACAAGCAGCCAGGTAG
Specificity
Primer specificity verified, maps on chromosome 6DL.
Polymorphism
KSUD17 HindIII
Linkage Group
6DL
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1.2
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUD17 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09