Query (optional)   in Class  

GrainGenes Marker Report: D019

[ Printable Version ]  [ Submit comment/correction ]

Locus
D019
Type
RFLP
Map
Tt-Gill-3D322.4
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuD19
Possible Orthologs
ksuD19
XksuD19
XksuD19-3
XksuD19-3B
XksuD19-3D



Probe for Locus
pTtksuD19
Locus
XksuD19
[ Show all 8 ]
Type
Genomic
STS
PCR primers
R:TGACCTCTTTGAGGACTGTC
L:TGTACATGGATTCAGACGAT
Polymorphism
KSUD19 XbaI
KSUD19 EcoRI
KSUD19 EcoRV
KSUD19 HindIII
KSUD19 DraI
Linkage Group
3D / 3DS,1
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1.6
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUD19 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09