Query (optional)   in Class  

GrainGenes Marker Report: D022

[ Printable Version ]  [ Submit comment/correction ]

Locus
D022
Type
RFLP
Map
Tt-Gill-2D288.3
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuD22
Possible Orthologs
ksuD22
[ Show all 7 ]



Probe for Locus
pTtksuD22
Locus
XksuD22
[ Show all 11 ]
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type
Genomic
STS
PCR primers
R:AGCAGGAACAAACACATCAT
L:TCGCCGTCACCCAACTCACC
Polymorphism
KSUD22 XbaI
KSUD22 EcoRI
KSUD22 EcoRV
KSUD22 HindIII
KSUD22 DraI
Linkage Group
2D / 2DL
2
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1.5
Clone Vector
pUC18
pUC
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Clone Authority
Gill, Bikram S.
Image
KSUD22 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Kleinhofs, Andris96.05.08
Gill, Bikram S.92.09