Query (optional)   in Class  

GrainGenes Marker Report: D023

[ Printable Version ]  [ Submit comment/correction ]

Locus
D023
Type
RFLP
Map
Tt-Gill-2D454.6
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuD23
Possible Orthologs
XksuD23
[ Show all 13 ]



Probe for Locus
pTtksuD23
Locus
XksuD23-2
[ Show all 13 ]
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type
Genomic
STS
PCR primers
R:AGGCAGTGAAGAAGAAGAACC
L:TTGAAATCGACAGGATTAGGA
Polymorphism
KSUD23 XbaI
KSUD23 EcoRI
KSUD23 EcoRV
KSUD23 HindIII
KSUD23 DraI
Linkage Group
2DL
Insert Enzyme
PstI
Source Species
Triticum tauschii
Insert Size
1.8
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUD23 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09