Query (optional)   in Class  

GrainGenes Marker Report: D030

[ Printable Version ]  [ Submit comment/correction ]

Locus
D030
Type
RFLP
Map
Tt-Gill-5D265.6
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuD30
Possible Orthologs
XksuD30
XksuD30-3B
XksuD30-5D
ksuD30
ksuD30-5D



Probe for Locus
pTtksuD30
Locus
XksuD30-5D
[ Show all 6 ]
Type
Genomic
STS
PCR primers
R:GACTTCTGGACGCTCGGGTA
L:TGTAGTACGCAGCCTGACAG
Polymorphism
KSUD30 DraI
Insert Enzyme
PstI
Source Species
Triticum tauschii
Clone Vector
pUC18
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUD30 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
Gill, Bikram S.92.09