Query (optional)   in Class  

GrainGenes Marker Report: D1.1_ctg10001

[ Printable Version ]  [ Submit comment/correction ]

Locus
D1.1_ctg10001
Type
BAC_contig
Map
Ta-Physical-Gill-2D4.98
[ Show Nearby Loci ]
Probe
pTtksuF2



Probe for Locus
pTtksuF2
Locus
ksuF2A
[ Show all 22 ]
Type
Genomic
STS
PCR primers
R:TTCGCCATTAGAGCAACCTG
L:GGAGATGGATTCCCTTGTCC
Polymorphism
KSUF2 DraI
Linkage Group
2D / 7D (5)
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
0.3
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUF2 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09