Query (optional)   in Class  

GrainGenes Marker Report: D1.1_ctg10105

[ Printable Version ]  [ Submit comment/correction ]

Locus
D1.1_ctg10105
Type
BAC_contig
Map
Ta-Gale-5D-1.5
Ta-Physical-Gill-5D0.9
[ Show Nearby Loci ]
Probe
pTtksuG44



Probe for Locus
pTtksuG44
Locus
XksuG44-6D
[ Show all 8 ]
Type
Genomic
STS
PCR primers
R:CAGCATTATACTGGACGATGC
L:GTACTGATCAAGTTCTGTCATCG
Specificity
Primer specificity verified, maps on chromosomes 5BL, 5DL.
Linkage Group
5D / 6DS
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09