Query (optional)   in Class  

GrainGenes Marker Report: D1.1_ctg11375

[ Printable Version ]  [ Submit comment/correction ]

Locus
D1.1_ctg11375
Type
BAC_contig
Map
Wheat-Composite2004-1D72
[ Show Nearby Loci ]
Probe
MWG967



Probe for Locus
MWG967
Locus
Xmwg967-1D
[ Show all 8 ]
Synonym
SynonymHAR35_6809
Type
Genomic
STS
STS primers
5' GCGACGGGCAGCAAGAAAAA
5' CTGAGGGCCAGTGGGATCTT
STS size
171
Amplification Conditions
STS annealing temperature 58-60 oC
Sequence
AJ234684
AJ234683
MWG967-5
MWG967-3
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Clone Vector
Bluescript
Excision Enzyme
PstI
Clone Location
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
Kuenzel, Gottfried00.03